| Detail of EST/Unigene BF635045 |
| Acc. | BF635045 |
| Internal Acc. | NF078H04DT1F1043 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Cinnamoyl-CoA reductase 1 OS=Arabidopsis thaliana E-value=3e-41; Tetraketide alpha-pyrone reductase 1 OS=Arabidopsis thaliana E-value=2e-38; Cinnamoyl-CoA reductase 2 OS=Arabidopsis thaliana E-value=3e-38; Dihydroflavonol-4-reductase OS=Vitis vinifera E-value=2e-35; Bifunctional dihydroflavonol 4-reductase/flavanone 4-reductase OS=Malus domestica E-value=8e-35; |
| Length | 668 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_Drought; |
| Sequence | AACAAAGGATTCACATAGATATAAGCCATGTCAAAGACAGTTTGTGTGACCGGAGCCAGC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00150 Androgen and estrogen metabolism > K00070 3beta-hydroxy-delta5-steroid dehydrogenase; Metabolism > Lipid Metabolism > ko00140 C21-Steroid hormone metabolism > K00070 3beta-hydroxy-delta5-steroid dehydrogenase; Metabolism > Lipid Metabolism > ko00100 Biosynthesis of steroids > K07748 sterol-4alpha-carboxylate 3-dehydrogenase (decarboxylating) |
| EC | 1.1.1.- 1.1.1.170 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 835962 |
| Trichome-related Gene from Literature | N/A |