Detail of EST/Unigene BF635126 |
Acc. | BF635126 |
Internal Acc. | NF081B05DT1F1044 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Beta-glucosidase 10 OS=Oryza sativa subsp. japonica E-value=2e-42; Beta-glucosidase 13 OS=Oryza sativa subsp. japonica E-value=3e-42; Beta-glucosidase 12 OS=Oryza sativa subsp. japonica E-value=4e-42; Beta-glucosidase 11 OS=Oryza sativa subsp. japonica E-value=3e-41; Beta-glucosidase 30 OS=Oryza sativa subsp. japonica E-value=3e-38; |
Length | 671 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Drought; |
Sequence | GAAAAATATAAAATATTGTCATTTTCTGTTAAATATTTGACATAGACAGTTCAAGAGGGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00052 Galactose metabolism > K01229 lactase; Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K05350 beta-glucosidase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K05350 beta-glucosidase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K05350 beta-glucosidase |
EC | 3.2.1.108 3.2.1.21 3.2.1.62 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 833656 |
Trichome-related Gene from Literature | N/A |