Detail of EST/Unigene BF635262 |
Acc. | BF635262 |
Internal Acc. | NF062E10DT1F1082 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Probable replication factor C subunit 3 OS=Dictyostelium discoideum E-value=1e-37; Replication factor C subunit 5 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=5e-34; Replication factor C subunit 5 OS=Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987) E-value=5e-33; Replication factor C subunit 3 OS=Bos taurus E-value=6e-32; Replication factor C subunit 3 OS=Mus musculus E-value=1e-31; |
Length | 567 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Drought; |
Sequence | GTGAGAACCCTAGACCGTCGCATCTGCAGCCTTCCACCCCGGCGCTCCTCTGTTCCGCTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Replication and Repair > ko03030 DNA replication > K10756 replication factor C subunit 3/5; Genetic Information Processing > Replication and Repair > ko03430 Mismatch repair > K10756 replication factor C subunit 3/5; Genetic Information Processing > Replication and Repair > ko03420 Nucleotide excision repair > K10756 replication factor C subunit 3/5 |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 832836 |
Trichome-related Gene from Literature | N/A |