| Detail of EST/Unigene BF635715 |
| Acc. | BF635715 |
| Internal Acc. | NF026E11DT1F1084 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Oxygen-evolving enhancer protein 1, chloroplastic OS=Pisum sativum E-value=2e-89; Oxygen-evolving enhancer protein 1, chloroplastic OS=Nicotiana tabacum E-value=2e-76; Oxygen-evolving enhancer protein 1, chloroplastic OS=Solanum tuberosum E-value=6e-76; Oxygen-evolving enhancer protein 1, chloroplastic OS=Solanum lycopersicum E-value=1e-73; Oxygen-evolving enhancer protein 1-1, chloroplastic OS=Arabidopsis thaliana E-value=3e-73; |
| Length | 590 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_Drought; |
| Sequence | GCAATGGCAGCCTCACTCCAAGCAGCTGCTACTCTCATGCAACCAACCAAGTTACGTAGC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 836789 |
| Trichome-related Gene from Literature | N/A |