| Detail of EST/Unigene BF635737 |
| Acc. | BF635737 |
| Internal Acc. | NF016D01DT1F1011 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Transketolase, chloroplastic OS=Spinacia oleracea E-value=4e-77; Transketolase, chloroplastic OS=Solanum tuberosum E-value=3e-76; Transketolase, chloroplastic OS=Zea mays E-value=2e-75; Transketolase, chloroplastic (Fragment) OS=Craterostigma plantagineum E-value=3e-74; Transketolase 7 OS=Craterostigma plantagineum E-value=3e-67; |
| Length | 507 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_Drought; |
| Sequence | CACTTGCCGGACATTGGGGTCTTGGAAAGCTAATTGCATTTTATGATGATAACCACATTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00030 Pentose phosphate pathway > K00615 transketolase; Metabolism > Energy Metabolism > ko00710 Carbon fixation in photosynthetic organisms > K00615 transketolase; Metabolism > Biosynthesis of Polyketides and Nonribosomal Peptides > ko01051 Biosynthesis of ansamycins > K00615 transketolase |
| EC | 2.2.1.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 819137 |
| Trichome-related Gene from Literature | N/A |