Detail of EST/Unigene BF635845 |
Acc. | BF635845 |
Internal Acc. | NF053B05DT1F1045 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Probable beta-1,3-galactosyltransferase 11 OS=Arabidopsis thaliana E-value=3e-44; Probable beta-1,3-galactosyltransferase 9 OS=Arabidopsis thaliana E-value=4e-17; Probable beta-1,3-galactosyltransferase 10 OS=Arabidopsis thaliana E-value=1e-16; Probable beta-1,3-galactosyltransferase 3 OS=Arabidopsis thaliana E-value=4e-06; |
Length | 615 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Drought; |
Sequence | CACAGACTCTCCACTATGGCGAATCGATCTCGAATCCCTGCACTCTTCATCTCCATGTTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 835415 |
Trichome-related Gene from Literature | N/A |