| Detail of EST/Unigene BF635944 |
| Acc. | BF635944 |
| Internal Acc. | NF051B04DT1F1041 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 50S ribosomal protein L21, chloroplastic OS=Spinacia oleracea E-value=8e-20; 50S ribosomal protein L21, chloroplastic OS=Arabidopsis thaliana E-value=3e-19; 50S ribosomal protein L21, mitochondrial OS=Arabidopsis thaliana E-value=5e-08; 50S ribosomal protein L21 OS=Dictyoglomus turgidum (strain Z-1310 / DSM 6724) E-value=1e-06; Probable 39S ribosomal protein L21, mitochondrial OS=Dictyostelium discoideum E-value=2e-06; |
| Length | 475 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_Drought; |
| Sequence | CAAAATGGCTTCTGCAACTGCTTCTACACTTTCAACTCTCTGTTCTTCTTTCACAACCCA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 840472 |
| Trichome-related Gene from Literature | N/A |