Detail of EST/Unigene BF635944 |
Acc. | BF635944 |
Internal Acc. | NF051B04DT1F1041 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 50S ribosomal protein L21, chloroplastic OS=Spinacia oleracea E-value=8e-20; 50S ribosomal protein L21, chloroplastic OS=Arabidopsis thaliana E-value=3e-19; 50S ribosomal protein L21, mitochondrial OS=Arabidopsis thaliana E-value=5e-08; 50S ribosomal protein L21 OS=Dictyoglomus turgidum (strain Z-1310 / DSM 6724) E-value=1e-06; Probable 39S ribosomal protein L21, mitochondrial OS=Dictyostelium discoideum E-value=2e-06; |
Length | 475 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Drought; |
Sequence | CAAAATGGCTTCTGCAACTGCTTCTACACTTTCAACTCTCTGTTCTTCTTTCACAACCCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 840472 |
Trichome-related Gene from Literature | N/A |