| Detail of EST/Unigene BF636044 |
| Acc. | BF636044 |
| Internal Acc. | NF077C12DT1F1097 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Nudix hydrolase 17, mitochondrial OS=Arabidopsis thaliana E-value=2e-51; Nudix hydrolase 18, mitochondrial OS=Arabidopsis thaliana E-value=9e-50; Nudix hydrolase 21, chloroplastic OS=Arabidopsis thaliana E-value=9e-48; Nudix hydrolase 4 OS=Arabidopsis thaliana E-value=2e-47; Nudix hydrolase 13, mitochondrial OS=Arabidopsis thaliana E-value=5e-35; |
| Length | 682 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_Drought; |
| Sequence | ATTCTAGTACAACCTATTTCCTCTCCCTTTCAAAATATTCTCCTTGCAGGCCAAAAATAC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 3.6.1.52 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 814696 |
| Trichome-related Gene from Literature | N/A |