| Detail of EST/Unigene BF636065 |
| Acc. | BF636065 |
| Internal Acc. | NF066D12DT1F1101 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glycine cleavage system H protein, mitochondrial OS=Pisum sativum E-value=1e-61; Glycine cleavage system H protein, mitochondrial OS=Flaveria pringlei E-value=1e-57; Glycine cleavage system H protein, mitochondrial OS=Flaveria anomala E-value=1e-57; Glycine cleavage system H protein, mitochondrial (Fragment) OS=Flaveria pubescens E-value=3e-57; Glycine cleavage system H protein, mitochondrial OS=Flaveria trinervia E-value=1e-55; |
| Length | 384 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_Drought; |
| Sequence | ATCTCTCCCCTCCTTTTTCCATCTCCAGATGTTTCTCAACTGTGTTGGATGGACTCAAGT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 840141 |
| Trichome-related Gene from Literature | N/A |