Detail of EST/Unigene BF636065 |
Acc. | BF636065 |
Internal Acc. | NF066D12DT1F1101 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glycine cleavage system H protein, mitochondrial OS=Pisum sativum E-value=1e-61; Glycine cleavage system H protein, mitochondrial OS=Flaveria pringlei E-value=1e-57; Glycine cleavage system H protein, mitochondrial OS=Flaveria anomala E-value=1e-57; Glycine cleavage system H protein, mitochondrial (Fragment) OS=Flaveria pubescens E-value=3e-57; Glycine cleavage system H protein, mitochondrial OS=Flaveria trinervia E-value=1e-55; |
Length | 384 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Drought; |
Sequence | ATCTCTCCCCTCCTTTTTCCATCTCCAGATGTTTCTCAACTGTGTTGGATGGACTCAAGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 840141 |
Trichome-related Gene from Literature | N/A |