Detail of EST/Unigene BF636174 |
Acc. | BF636174 |
Internal Acc. | NF061G06DT1F1051 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Probable aminotransferase TAT2 OS=Arabidopsis thaliana E-value=3e-91; S-alkyl-thiohydroximate lyase SUR1 OS=Arabidopsis thaliana E-value=6e-65; Nicotianamine aminotransferase A OS=Hordeum vulgare E-value=3e-60; Nicotianamine aminotransferase B OS=Hordeum vulgare E-value=6e-60; Tyrosine aminotransferase OS=Arabidopsis thaliana E-value=1e-59; |
Length | 682 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Drought; |
Sequence | CAATGAACCATGAATGCAAAGCAACTTCAACTATCACAATTAAGGGTATTTTGAGTCTTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00950 Alkaloid biosynthesis I > K00815 tyrosine aminotransferase; Metabolism > Biosynthesis of Secondary Metabolites > ko00401 Novobiocin biosynthesis > K00815 tyrosine aminotransferase; Metabolism > Amino Acid Metabolism > ko00271 Methionine metabolism > K00815 tyrosine aminotransferase; Metabolism > Amino Acid Metabolism > ko00360 Phenylalanine metabolism > K00815 tyrosine aminotransferase; Metabolism > Amino Acid Metabolism > ko00400 Phenylalanine, tyrosine and tryptophan biosynthesis > K00815 tyrosine aminotransferase; Metabolism > Amino Acid Metabolism > ko00350 Tyrosine metabolism > K00815 tyrosine aminotransferase |
EC | 2.6.1.5 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 835480 |
Trichome-related Gene from Literature | N/A |