Detail of EST/Unigene BF636181 |
Acc. | BF636181 |
Internal Acc. | NF109D07DT1F1060 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | ATP synthase delta chain, chloroplastic OS=Pisum sativum E-value=2e-53; ATP synthase delta chain, chloroplastic OS=Nicotiana tabacum E-value=6e-36; ATP synthase delta chain, chloroplastic OS=Spinacia oleracea E-value=1e-25; ATP synthase delta chain, chloroplastic OS=Sorghum bicolor E-value=6e-21; ATP synthase delta chain, chloroplastic OS=Chlamydomonas reinhardtii E-value=2e-11; |
Length | 627 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Drought; |
Sequence | ACACTCTCTTCATTTCATTTCACTAACCACACCACACTAATTTCTTCTTCATCTACCAAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 3.6.3.14 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 826551 |
Trichome-related Gene from Literature | N/A |