Detail of EST/Unigene BF636285 |
Acc. | BF636285 |
Internal Acc. | NF109C09DT1F1068 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase 7 OS=Arabidopsis thaliana E-value=9e-48; Glucan endo-1,3-beta-glucosidase OS=Triticum aestivum E-value=8e-32; Glucan endo-1,3-beta-glucosidase-like protein 3 OS=Arabidopsis thaliana E-value=3e-21; Glucan endo-1,3-beta-glucosidase-like protein 2 OS=Arabidopsis thaliana E-value=5e-21; Glucan endo-1,3-beta-glucosidase 3 OS=Arabidopsis thaliana E-value=1e-20; |
Length | 529 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Drought; |
Sequence | CTTTGATGCCAGGAAAATCCATTGACACATACATTTTTGCACTCTATGATGAAGATTTGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 829599 |
Trichome-related Gene from Literature | N/A |