Detail of EST/Unigene BF636323 |
Acc. | BF636323 |
Internal Acc. | NF088D02DT1F1025 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Acyl-coenzyme A oxidase 2, peroxisomal OS=Arabidopsis thaliana E-value=2e-77; Acyl-coenzyme A oxidase, peroxisomal OS=Cucurbita maxima E-value=1e-76; Putative acyl-coenzyme A oxidase 3.2, peroxisomal OS=Arabidopsis thaliana E-value=2e-15; Acyl-coenzyme A oxidase 3, peroxisomal OS=Arabidopsis thaliana E-value=3e-15; Acyl-coenzyme A oxidase-like protein OS=Homo sapiens E-value=8e-14; |
Length | 660 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Drought; |
Sequence | CTCCTCTAATCTCACTTCAAATCCAATCAACCCCAAACTCGCACAAAATGCAAACCCTAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00592 alpha-Linolenic acid metabolism > K00232 acyl-CoA oxidase; Metabolism > Lipid Metabolism > ko01040 Biosynthesis of unsaturated fatty acids > K00232 acyl-CoA oxidase; Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K00232 acyl-CoA oxidase |
EC | 1.3.3.6 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 836635 |
Trichome-related Gene from Literature | N/A |