| Detail of EST/Unigene BF636723 |
| Acc. | BF636723 |
| Internal Acc. | NF048H06LF1F1057 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 50S ribosomal protein L12, chloroplastic OS=Nicotiana tabacum E-value=1e-28; 50S ribosomal protein L12, chloroplastic OS=Nicotiana sylvestris E-value=1e-28; 50S ribosomal protein L12, chloroplastic OS=Spinacia oleracea E-value=1e-26; 50S ribosomal protein L12, chloroplastic OS=Oryza sativa subsp. japonica E-value=5e-26; 50S ribosomal protein L12-3, chloroplastic OS=Arabidopsis thaliana E-value=3e-25; |
| Length | 357 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DLEAF; |
| Sequence | CCCGCCGCCGCCGCCGTTGCTGCACCCGCCGCTGAAGCTGCCGTCGTCGAAGAAAAGACC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 822403 |
| Trichome-related Gene from Literature | N/A |