| Detail of EST/Unigene BF636741 |
| Acc. | BF636741 |
| Internal Acc. | NF055B12ST1F1000 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Guanine nucleotide-binding protein subunit beta-like protein OS=Medicago sativa E-value=0; Guanine nucleotide-binding protein subunit beta-like protein OS=Glycine max E-value=0; Guanine nucleotide-binding protein subunit beta-like protein A OS=Arabidopsis thaliana E-value=1e-89; Guanine nucleotide-binding protein subunit beta-like protein B OS=Arabidopsis thaliana E-value=2e-89; Guanine nucleotide-binding protein subunit beta-like protein C OS=Arabidopsis thaliana E-value=3e-89; |
| Length | 601 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSTEM2; |
| Sequence | CCACAGAAACCACCAATCATGGCTGAGGGTCTTGTTCTTCGCGGCACCATGCGTGCTCAC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Genetic Information Processing > Folding, Sorting and Degradation > ko04120 Ubiquitin mediated proteolysis > K03362 F-box and WD-40 domain protein 1/11; Environmental Information Processing > Signal Transduction > ko04340 Hedgehog signaling pathway > K03362 F-box and WD-40 domain protein 1/11; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K03362 F-box and WD-40 domain protein 1/11 |
| EC | 2.1.1.63 |
| Transcription Factor Family | C3H |
| Transporter Classification Family | 3.A.2 H+- or Na+-translocating F-type, V-type and A-type ATPase superfamily F-ATPase |
| Probeset |
|
| Corresponding NCBI Gene | 838388 |
| Trichome-related Gene from Literature | N/A |