Detail of EST/Unigene BF636978 |
Acc. | BF636978 |
Internal Acc. | NF072E06LF1F1040 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 30S ribosomal protein S2, chloroplastic OS=Lotus japonicus E-value=1e-81; 30S ribosomal protein S2, chloroplastic OS=Pisum sativum E-value=2e-81; 30S ribosomal protein S2, chloroplastic OS=Eucalyptus globulus subsp. globulus E-value=3e-77; 30S ribosomal protein S2, chloroplastic OS=Cucumis sativus E-value=3e-77; 30S ribosomal protein S2, chloroplastic OS=Vitis vinifera E-value=4e-77; |
Length | 673 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF; |
Sequence | ATCGTCTAGAAAAGAGAAGGTTCCATCGGAACAATTATTTATTGCTATTTCAGGATACCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |