Detail of EST/Unigene BF637019 |
Acc. | BF637019 |
Internal Acc. | NF076E01LF1F1004 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Oxygen-evolving enhancer protein 2, chloroplastic OS=Pisum sativum E-value=2e-94; Oxygen-evolving enhancer protein 2, chloroplastic OS=Spinacia oleracea E-value=9e-74; Oxygen-evolving enhancer protein 2, chloroplastic OS=Solanum tuberosum E-value=1e-71; Oxygen-evolving enhancer protein 2, chloroplastic OS=Solanum lycopersicum E-value=6e-70; Oxygen-evolving enhancer protein 2-1, chloroplastic OS=Nicotiana tabacum E-value=9e-69; |
Length | 669 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF; |
Sequence | CCTCGTGCCGCACAAGAAAAATAAACTATACTAGACTCTAGCAAAATGGCCTCTACACAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 837178 |
Trichome-related Gene from Literature | N/A |