Detail of EST/Unigene BF637057 |
Acc. | BF637057 |
Internal Acc. | NF050D08LF1F1063 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 215, chloroplastic OS=Pisum sativum E-value=9e-74; Chlorophyll a-b binding protein 37, chloroplastic OS=Petunia sp. E-value=9e-64; Chlorophyll a-b binding protein 36, chloroplastic OS=Nicotiana tabacum E-value=2e-63; Chlorophyll a-b binding protein 4, chloroplastic OS=Solanum lycopersicum E-value=3e-63; Chlorophyll a-b binding protein 151, chloroplastic OS=Gossypium hirsutum E-value=3e-63; |
Length | 524 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF; |
Sequence | AAGAAACCTCAACGCCCTCATGGCCACCTCTGCAATCCAACAATCAGCATTCACTGGAAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 815058 |
Trichome-related Gene from Literature | N/A |