Detail of EST/Unigene BF637075 |
Acc. | BF637075 |
Internal Acc. | NF050B09LF1F1074 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Phosphoglucomutase, cytoplasmic OS=Pisum sativum E-value=3e-71; Phosphoglucomutase, cytoplasmic OS=Populus tremula E-value=1e-64; Phosphoglucomutase, cytoplasmic OS=Bromus inermis E-value=1e-62; Probable phosphoglucomutase, cytoplasmic 1 OS=Arabidopsis thaliana E-value=2e-62; Probable phosphoglucomutase, cytoplasmic 2 OS=Arabidopsis thaliana E-value=5e-62; |
Length | 435 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF; |
Sequence | GGAAAATGGTGGACCTGCACCAGAGGGAATTACCAACAAAATATATGAATACACAACAAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00521 Streptomycin biosynthesis > K01835 phosphoglucomutase; Metabolism > Carbohydrate Metabolism > ko00052 Galactose metabolism > K01835 phosphoglucomutase; Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K01835 phosphoglucomutase; Metabolism > Carbohydrate Metabolism > ko00030 Pentose phosphate pathway > K01835 phosphoglucomutase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K01835 phosphoglucomutase |
EC | 5.4.2.2 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 838927 |
Trichome-related Gene from Literature | N/A |