Detail of EST/Unigene BF637077 |
Acc. | BF637077 |
Internal Acc. | NF048D08LF1F1063 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Linoleate 13S-lipoxygenase 2-1, chloroplastic OS=Solanum tuberosum E-value=4e-50; Probable lipoxygenase 8, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-44; Lipoxygenase 2.3, chloroplastic OS=Hordeum vulgare E-value=5e-44; Lipoxygenase 2.2, chloroplastic OS=Hordeum vulgare E-value=4e-41; Lipoxygenase 2.1, chloroplastic OS=Hordeum vulgare E-value=1e-40; |
Length | 489 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF; |
Sequence | ATTTGTATGCATGTTTTGCACTGCCTAATCAATTCTTCTCTTTTGAACAGTCATATTTAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 843584 |
Trichome-related Gene from Literature | N/A |