| Detail of EST/Unigene BF637077 |
| Acc. | BF637077 |
| Internal Acc. | NF048D08LF1F1063 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Linoleate 13S-lipoxygenase 2-1, chloroplastic OS=Solanum tuberosum E-value=4e-50; Probable lipoxygenase 8, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-44; Lipoxygenase 2.3, chloroplastic OS=Hordeum vulgare E-value=5e-44; Lipoxygenase 2.2, chloroplastic OS=Hordeum vulgare E-value=4e-41; Lipoxygenase 2.1, chloroplastic OS=Hordeum vulgare E-value=1e-40; |
| Length | 489 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DLEAF; |
| Sequence | ATTTGTATGCATGTTTTGCACTGCCTAATCAATTCTTCTCTTTTGAACAGTCATATTTAC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 843584 |
| Trichome-related Gene from Literature | N/A |