Detail of EST/Unigene BF637140 |
Acc. | BF637140 |
Internal Acc. | NF073B03LF1F1026 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Sedoheptulose-1,7-bisphosphatase, chloroplastic OS=Spinacia oleracea E-value=1e-61; Sedoheptulose-1,7-bisphosphatase, chloroplastic OS=Arabidopsis thaliana E-value=1e-58; Sedoheptulose-1,7-bisphosphatase, chloroplastic OS=Triticum aestivum E-value=1e-51; Sedoheptulose-1,7-bisphosphatase, chloroplastic OS=Chlamydomonas reinhardtii E-value=2e-34; |
Length | 591 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF; |
Sequence | CAAAACTTTTCAACATAATTTTTTTTTCAGCCATGGAAACTAGTATAGCATGTTACTCCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824746 |
Trichome-related Gene from Literature | N/A |