Detail of EST/Unigene BF637189 |
Acc. | BF637189 |
Internal Acc. | NF074D09LF1F1075 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein CP26, chloroplastic OS=Arabidopsis thaliana E-value=1e-48; Chlorophyll a-b binding protein of LHCII type I, chloroplastic OS=Dunaliella tertiolecta E-value=6e-19; Chlorophyll a-b binding protein 151, chloroplastic OS=Gossypium hirsutum E-value=4e-18; Chlorophyll a-b binding protein type 2 member 1B, chloroplastic OS=Pinus sylvestris E-value=7e-18; Chlorophyll a-b binding protein M9, chloroplastic OS=Zea mays E-value=7e-18; |
Length | 514 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF; |
Sequence | CAACAAATTAATTCATCAAAGCTTAGTTTGAGTTGAAGATTCCTAAAACCAACCATGGCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 826626 |
Trichome-related Gene from Literature | N/A |