Detail of EST/Unigene BF637271 |
Acc. | BF637271 |
Internal Acc. | NF074F12LF1F1096 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 50S ribosomal protein L22, chloroplastic OS=Medicago sativa E-value=2e-52; 50S ribosomal protein L22, chloroplastic OS=Pisum sativum E-value=2e-45; 50S ribosomal protein L22, chloroplastic OS=Solanum lycopersicum E-value=4e-34; 50S ribosomal protein L22, chloroplastic OS=Solanum bulbocastanum E-value=4e-34; 50S ribosomal protein L22, chloroplastic OS=Solanum tuberosum E-value=9e-34; |
Length | 576 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF; |
Sequence | CAAATACCAATGCCAAAACATTTGATTATAGAATTAAGTTGAATATTCAAACAGTTCTAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |