| Detail of EST/Unigene BF637293 |
| Acc. | BF637293 |
| Internal Acc. | NF049H05LF1F1045 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Leucine aminopeptidase 3, chloroplastic OS=Arabidopsis thaliana E-value=1e-39; Leucine aminopeptidase 2, chloroplastic OS=Solanum lycopersicum E-value=6e-39; Leucine aminopeptidase 2, chloroplastic OS=Arabidopsis thaliana E-value=6e-39; Leucine aminopeptidase 1 OS=Arabidopsis thaliana E-value=3e-36; Leucine aminopeptidase 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=6e-35; |
| Length | 476 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DLEAF; |
| Sequence | CTTTCTCAAAATCTTCGTCTTCTTCTCTCTTTCTCACTTCGCGTATTCGTTTTGCTTCAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 829216 |
| Trichome-related Gene from Literature | N/A |