Detail of EST/Unigene BF637446 |
Acc. | BF637446 |
Internal Acc. | NF025F07PL1F1061 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Thioredoxin-like 3-1, chloroplastic OS=Arabidopsis thaliana E-value=2e-40; Thioredoxin-like 3-1, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-32; Thioredoxin-like 3-2, chloroplastic OS=Arabidopsis thaliana E-value=2e-26; Thioredoxin M4, chloroplastic OS=Arabidopsis thaliana E-value=3e-08; Thioredoxin M-type, chloroplastic OS=Pisum sativum E-value=5e-08; |
Length | 641 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF; |
Sequence | AAAATTTATCACCATTCTCTTTCCTTTTCTTAGCATCCAACTTCATGCCTTGTCCACTAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 830558 |
Trichome-related Gene from Literature | N/A |