| Detail of EST/Unigene BF637446 |
| Acc. | BF637446 |
| Internal Acc. | NF025F07PL1F1061 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Thioredoxin-like 3-1, chloroplastic OS=Arabidopsis thaliana E-value=2e-40; Thioredoxin-like 3-1, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-32; Thioredoxin-like 3-2, chloroplastic OS=Arabidopsis thaliana E-value=2e-26; Thioredoxin M4, chloroplastic OS=Arabidopsis thaliana E-value=3e-08; Thioredoxin M-type, chloroplastic OS=Pisum sativum E-value=5e-08; |
| Length | 641 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_PhoLEAF; |
| Sequence | AAAATTTATCACCATTCTCTTTCCTTTTCTTAGCATCCAACTTCATGCCTTGTCCACTAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 830558 |
| Trichome-related Gene from Literature | N/A |