Detail of EST/Unigene BF637473 |
Acc. | BF637473 |
Internal Acc. | NF029A05PL1F1035 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | ATP synthase subunit a, chloroplastic OS=Triticum aestivum E-value=3e-20; ATP synthase subunit a, chloroplastic OS=Vitis vinifera E-value=3e-20; ATP synthase subunit a, chloroplastic OS=Trachelium caeruleum E-value=3e-20; ATP synthase subunit a, chloroplastic OS=Staurastrum punctulatum E-value=3e-20; ATP synthase subunit a, chloroplastic OS=Glycine max E-value=3e-20; |
Length | 640 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF; |
Sequence | AGAAGATTTTACAAAACCCTTATCGCTTAGTTTTCGACTTTTCGGAAATATATTAGCTGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |