Detail of EST/Unigene BF637542 |
Acc. | BF637542 |
Internal Acc. | NF030B03PL1F1027 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Putative quinone-oxidoreductase homolog, chloroplastic OS=Arabidopsis thaliana E-value=1e-70; Quinone-oxidoreductase homolog, chloroplastic OS=Spinacia oleracea E-value=6e-67; Quinone oxidoreductase-like protein At1g23740, chloroplastic OS=Arabidopsis thaliana E-value=1e-22; Reticulon-4-interacting protein 1 homolog, mitochondrial OS=Danio rerio E-value=5e-22; Reticulon-4-interacting protein 1, mitochondrial OS=Homo sapiens E-value=3e-21; |
Length | 598 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF; |
Sequence | AAAATCCGAAGATTCTGGAGAAAGTTAGATAATATGGCTGCGAAACTTATGCAAGCTCTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 1.6.5.5 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 826914 |
Trichome-related Gene from Literature | N/A |