| Detail of EST/Unigene BF637682 |
| Acc. | BF637682 |
| Internal Acc. | NF032E09PL1F1069 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Thioredoxin F-type, chloroplastic OS=Pisum sativum E-value=2e-10; Thioredoxin F1, chloroplastic OS=Arabidopsis thaliana E-value=2e-09; Thioredoxin F-type, chloroplastic OS=Brassica napus E-value=6e-09; Thioredoxin F, chloroplastic OS=Oryza sativa subsp. japonica E-value=4e-08; Thioredoxin F2, chloroplastic OS=Arabidopsis thaliana E-value=6e-08; |
| Length | 367 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_PhoLEAF; |
| Sequence | GGTGGTTCCCACTTTTAAAATTCTGAAAGACAGCAAGATTGTAAAAGAAGTAACTGGAGC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 821260 |
| Trichome-related Gene from Literature | N/A |