Detail of EST/Unigene BF637691 |
Acc. | BF637691 |
Internal Acc. | NF040B07PL1F1059 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 30S ribosomal protein S2, chloroplastic OS=Lotus japonicus E-value=3e-94; 30S ribosomal protein S2, chloroplastic OS=Pisum sativum E-value=5e-94; 30S ribosomal protein S2, chloroplastic OS=Carica papaya E-value=4e-90; 30S ribosomal protein S2, chloroplastic OS=Morus indica E-value=8e-90; 30S ribosomal protein S2, chloroplastic OS=Eucalyptus globulus subsp. globulus E-value=8e-90; |
Length | 643 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF; |
Sequence | AAAAGAGAAGGTTCCATCGGAACAATTATTTATTGCTATTTCAGGATACCTGGTCTCGTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |