Detail of EST/Unigene BF637769 |
Acc. | BF637769 |
Internal Acc. | NF042A01PL1F1003 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Photosystem I reaction center subunit XI, chloroplastic OS=Spinacia oleracea E-value=4e-49; Photosystem I reaction center subunit XI, chloroplastic OS=Arabidopsis thaliana E-value=1e-48; Photosystem I reaction center subunit XI, chloroplastic OS=Cucumis sativus E-value=2e-48; Photosystem I reaction center subunit XI, chloroplastic OS=Hordeum vulgare E-value=2e-39; Photosystem I reaction center subunit XI OS=Guillardia theta E-value=2e-20; |
Length | 516 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF; |
Sequence | GCACCTTTAAGTCATGGCAGCTGCTTCTCCTATGGCAAGCCAACTCAAGTCCAGCTTCAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 826892 |
Trichome-related Gene from Literature | N/A |