Detail of EST/Unigene BF637982 |
Acc. | BF637982 |
Internal Acc. | NF031D03PL1F1028 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 50S ribosomal protein L22, chloroplastic OS=Medicago sativa E-value=5e-74; 50S ribosomal protein L22, chloroplastic OS=Pisum sativum E-value=2e-50; 50S ribosomal protein L22, chloroplastic OS=Ranunculus macranthus E-value=3e-25; 50S ribosomal protein L22, chloroplastic OS=Solanum lycopersicum E-value=1e-24; 50S ribosomal protein L22, chloroplastic OS=Solanum bulbocastanum E-value=1e-24; |
Length | 528 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF; |
Sequence | GAGAAAGTTGAAGTGTTCGTTCAGCGTTTCATTCATCTTCTTCCTTCCTTCCCAATTTCC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |