Detail of EST/Unigene BF638023 |
Acc. | BF638023 |
Internal Acc. | NF027B07PL1F1059 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Seed linoleate 9S-lipoxygenase OS=Glycine max E-value=2e-93; Linoleate 9S-lipoxygenase 1 OS=Phaseolus vulgaris E-value=2e-93; Seed linoleate 9S-lipoxygenase-3 OS=Glycine max E-value=7e-92; Seed linoleate 9S-lipoxygenase-2 OS=Glycine max E-value=4e-88; Seed linoleate 9S-lipoxygenase-3 OS=Pisum sativum E-value=2e-86; |
Length | 642 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF; |
Sequence | CGGCCCTTAAGGAAATCTTTCGCACTGACGGTGAACAAGTCCTCAAGTTTCCACCTCCTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K00458 arachidonate 12-lipoxygenase; Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K08021 arachidonate 12-lipoxygenase (R-type); Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K08022 arachidonate 15-lipoxygenase (second type) / 8-lipoxygenase (S-type) |
EC | 1.13.11.- 1.13.11.33 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 821808 |
Trichome-related Gene from Literature | N/A |