Detail of EST/Unigene BF638075 |
Acc. | BF638075 |
Internal Acc. | NF040C06PL1F1040 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein type 2 member 1B, chloroplastic OS=Pinus sylvestris E-value=5e-23; Chlorophyll a-b binding protein 1A, chloroplastic OS=Pyrus pyrifolia E-value=5e-23; Chlorophyll a-b binding protein type 2 member 1A, chloroplastic OS=Pinus sylvestris E-value=5e-23; Chlorophyll a-b binding protein M9, chloroplastic OS=Zea mays E-value=9e-23; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=9e-23; |
Length | 305 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF; |
Sequence | AAAATGGTAGGTTAGCTATGTTCTCTATGTTTGGATTTTTCGTTCAAGCCATTGTGACTG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839871 |
Trichome-related Gene from Literature | 839871 |