Detail of EST/Unigene BF638133 |
Acc. | BF638133 |
Internal Acc. | NF044B06PL1F1047 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=3e-41; Chlorophyll a-b binding protein C, chloroplastic OS=Nicotiana plumbaginifolia E-value=3e-41; Chlorophyll a-b binding protein 21, chloroplastic OS=Nicotiana tabacum E-value=3e-41; Chlorophyll a-b binding protein 1D (Fragment) OS=Solanum lycopersicum E-value=6e-41; Chlorophyll a-b binding protein 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=6e-41; |
Length | 412 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF; |
Sequence | GGTTGACCCACTCTACCCAGGTGGCAGCTTTGACCCCTTGGGCCTTGCCGAAGATCCCGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839871 |
Trichome-related Gene from Literature | 839871 |