| Detail of EST/Unigene BF638227 |
| Acc. | BF638227 |
| Internal Acc. | NF045E08PL1F1065 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 30S ribosomal protein S3, chloroplastic OS=Lotus japonicus E-value=8e-60; 30S ribosomal protein S3, chloroplastic OS=Olimarabidopsis pumila E-value=7e-58; 30S ribosomal protein S3, chloroplastic OS=Nasturtium officinale E-value=7e-58; 30S ribosomal protein S3, chloroplastic OS=Lepidium virginicum E-value=7e-58; 30S ribosomal protein S3, chloroplastic OS=Capsella bursa-pastoris E-value=7e-58; |
| Length | 686 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_PhoLEAF; |
| Sequence | CCTCGAAGAATCGAAGAATTACAGACTAATGTACAAAAAAAACTTAATTGTGTGACGCGA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |