Detail of EST/Unigene BF638227 |
Acc. | BF638227 |
Internal Acc. | NF045E08PL1F1065 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 30S ribosomal protein S3, chloroplastic OS=Lotus japonicus E-value=8e-60; 30S ribosomal protein S3, chloroplastic OS=Olimarabidopsis pumila E-value=7e-58; 30S ribosomal protein S3, chloroplastic OS=Nasturtium officinale E-value=7e-58; 30S ribosomal protein S3, chloroplastic OS=Lepidium virginicum E-value=7e-58; 30S ribosomal protein S3, chloroplastic OS=Capsella bursa-pastoris E-value=7e-58; |
Length | 686 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF; |
Sequence | CCTCGAAGAATCGAAGAATTACAGACTAATGTACAAAAAAAACTTAATTGTGTGACGCGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |