Detail of EST/Unigene BF638236 |
Acc. | BF638236 |
Internal Acc. | NF045F01PL1F1013 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Calvin cycle protein CP12-2, chloroplastic OS=Arabidopsis thaliana E-value=6e-28; Calvin cycle protein CP12-1, chloroplastic OS=Arabidopsis thaliana E-value=4e-25; Calvin cycle protein CP12, chloroplastic OS=Chlamydomonas reinhardtii E-value=4e-11; Calvin cycle protein CP12-3, chloroplastic OS=Arabidopsis thaliana E-value=6e-11; |
Length | 549 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF; |
Sequence | ATTAGAATGGCAACAATAGGTGGTCTCAGCAGCCTTTCAAACCCCAAGCTTCTCTTCAAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 825414 |
Trichome-related Gene from Literature | N/A |