| Detail of EST/Unigene BF638313 |
| Acc. | BF638313 |
| Internal Acc. | NF044G07PL1F1054 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 30S ribosomal protein S8, chloroplastic OS=Glycine max E-value=3e-29; 30S ribosomal protein S8, chloroplastic OS=Phaseolus angularis E-value=3e-28; 30S ribosomal protein S8, chloroplastic OS=Olimarabidopsis pumila E-value=4e-28; 30S ribosomal protein S8, chloroplastic OS=Capsella bursa-pastoris E-value=4e-28; 30S ribosomal protein S8, chloroplastic OS=Arabis hirsuta E-value=7e-28; |
| Length | 662 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_PhoLEAF; |
| Sequence | AATGAAATCTATATATATATTGAATATATATATAGATATAGATAGATTCAAAATACAAAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |