| Detail of EST/Unigene BF638509 |
| Acc. | BF638509 |
| Internal Acc. | NF054A07PL1F1051 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Thiamine thiazole synthase, chloroplastic OS=Citrus sinensis E-value=3e-88; Thiamine thiazole synthase 2, chloroplastic OS=Vitis vinifera E-value=1e-87; Thiamine thiazole synthase 2, chloroplastic OS=Sorghum bicolor E-value=9e-87; Thiamine thiazole synthase 1, chloroplastic OS=Vitis vinifera E-value=2e-86; Thiamine thiazole synthase 1, chloroplastic OS=Zea mays E-value=1e-85; |
| Length | 521 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_PhoLEAF; |
| Sequence | TCTCTCGTGAAATGACCCGTCGTTACATGACAGACATGATCACCTACGCCGACACCGACG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 835567 |
| Trichome-related Gene from Literature | N/A |