| Detail of EST/Unigene BF638578 |
| Acc. | BF638578 |
| Internal Acc. | NF062E11PL1F1085 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | ATP synthase subunit a, chloroplastic OS=Pisum sativum E-value=2e-59; ATP synthase subunit a, chloroplastic OS=Cicer arietinum E-value=4e-58; ATP synthase subunit a, chloroplastic OS=Lotus japonicus E-value=1e-55; ATP synthase subunit a, chloroplastic OS=Glycine max E-value=2e-54; ATP synthase subunit a, chloroplastic OS=Aethionema grandiflora E-value=1e-53; |
| Length | 540 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_PhoLEAF; |
| Sequence | TAGATTTATGGAATCGGTTATTATAGCATTACAAAATTGTGCAAAAATAAATATTTTGTG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |