Detail of EST/Unigene BF638578 |
Acc. | BF638578 |
Internal Acc. | NF062E11PL1F1085 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | ATP synthase subunit a, chloroplastic OS=Pisum sativum E-value=2e-59; ATP synthase subunit a, chloroplastic OS=Cicer arietinum E-value=4e-58; ATP synthase subunit a, chloroplastic OS=Lotus japonicus E-value=1e-55; ATP synthase subunit a, chloroplastic OS=Glycine max E-value=2e-54; ATP synthase subunit a, chloroplastic OS=Aethionema grandiflora E-value=1e-53; |
Length | 540 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF; |
Sequence | TAGATTTATGGAATCGGTTATTATAGCATTACAAAATTGTGCAAAAATAAATATTTTGTG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |