Detail of EST/Unigene BF638713 |
Acc. | BF638713 |
Internal Acc. | NF064A05PL1F1035 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein type 2 member 1A, chloroplastic OS=Pinus sylvestris E-value=6e-55; Chlorophyll a-b binding protein 1A, chloroplastic OS=Pyrus pyrifolia E-value=3e-54; Chlorophyll a-b binding protein, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-51; Chlorophyll a-b binding protein, chloroplastic OS=Oryza sativa subsp. indica E-value=2e-51; Chlorophyll a-b binding protein 4, chloroplastic OS=Solanum lycopersicum E-value=3e-51; |
Length | 593 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF; |
Sequence | CTTGGGTAACCCAAGTCTAGTCCATGCACAAAGCATCCTTGCTATATGGGCTGTCCAAGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839871 |
Trichome-related Gene from Literature | 839871 |