| Detail of EST/Unigene BF638977 |
| Acc. | BF638977 |
| Internal Acc. | NF080F01PL1F1013 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Argininosuccinate lyase OS=Azotobacter vinelandii (strain DJ / ATCC BAA-1303) E-value=8e-26; Argininosuccinate lyase OS=Pseudomonas aeruginosa (strain LESB58) E-value=2e-25; Argininosuccinate lyase OS=Pseudomonas aeruginosa (strain ATCC 15692 / PAO1 / 1C / PRS 101 / LMG 12228) E-value=2e-25; Argininosuccinate lyase OS=Pseudomonas aeruginosa (strain UCBPP-PA14) E-value=2e-25; Argininosuccinate lyase OS=Pseudomonas aeruginosa (strain PA7) E-value=2e-25; |
| Length | 460 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_PhoLEAF; |
| Sequence | CTTCAGCTCTCTCTTCTTCTTCTTCTTCTTTCACACTACCTTCTCCACTCCGCACCCACT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00252 Alanine and aspartate metabolism > K01755 argininosuccinate lyase; Metabolism > Amino Acid Metabolism > ko00330 Arginine and proline metabolism > K01755 argininosuccinate lyase; Metabolism > Amino Acid Metabolism > ko00220 Urea cycle and metabolism of amino groups > K01755 argininosuccinate lyase |
| EC | 4.3.2.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 830959 |
| Trichome-related Gene from Literature | N/A |