Detail of EST/Unigene BF639039 |
Acc. | BF639039 |
Internal Acc. | NF094C08PL1F1056 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Omega-3 fatty acid desaturase, chloroplastic OS=Ricinus communis E-value=1e-56; Omega-3 fatty acid desaturase, chloroplastic (Fragment) OS=Brassica napus E-value=1e-55; Omega-3 fatty acid desaturase, chloroplastic OS=Arabidopsis thaliana E-value=4e-55; Omega-3 fatty acid desaturase, endoplasmic reticulum OS=Vigna radiata var. radiata E-value=6e-55; Temperature-sensitive omega-3 fatty acid desaturase, chloroplastic OS=Arabidopsis thaliana E-value=6e-55; |
Length | 613 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF; |
Sequence | TATTTTCGAGCCTCCACCACCACAACAACATTGTTAGCAGAGAGAACATCAACAACAATG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820288 |
Trichome-related Gene from Literature | 820288 |