| Detail of EST/Unigene BF639039 |
| Acc. | BF639039 |
| Internal Acc. | NF094C08PL1F1056 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Omega-3 fatty acid desaturase, chloroplastic OS=Ricinus communis E-value=1e-56; Omega-3 fatty acid desaturase, chloroplastic (Fragment) OS=Brassica napus E-value=1e-55; Omega-3 fatty acid desaturase, chloroplastic OS=Arabidopsis thaliana E-value=4e-55; Omega-3 fatty acid desaturase, endoplasmic reticulum OS=Vigna radiata var. radiata E-value=6e-55; Temperature-sensitive omega-3 fatty acid desaturase, chloroplastic OS=Arabidopsis thaliana E-value=6e-55; |
| Length | 613 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_PhoLEAF; |
| Sequence | TATTTTCGAGCCTCCACCACCACAACAACATTGTTAGCAGAGAGAACATCAACAACAATG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 820288 |
| Trichome-related Gene from Literature | 820288 |