Detail of EST/Unigene BF639089 |
Acc. | BF639089 |
Internal Acc. | NF079C11PL1F1084 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 50S ribosomal protein L2, chloroplastic OS=Panax ginseng E-value=3e-27; 50S ribosomal protein L2, chloroplastic OS=Lactuca sativa E-value=3e-27; 50S ribosomal protein L2, chloroplastic OS=Helianthus annuus E-value=2e-26; 50S ribosomal protein L2, chloroplastic OS=Drimys granadensis E-value=2e-26; 50S ribosomal protein L2, chloroplastic OS=Ceratophyllum demersum E-value=2e-26; |
Length | 395 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF; |
Sequence | CTAGGACAGAAATAAAACATTGGGTCGAACTCTTTTTTGGTGTCAAGGTAATAGCTATGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |