Detail of EST/Unigene BF639451 |
Acc. | BF639451 |
Internal Acc. | NF012A07IN1F1050 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | GDP-mannose 3,5-epimerase OS=Arabidopsis thaliana E-value=2e-64; GDP-mannose 3,5-epimerase 1 OS=Oryza sativa subsp. japonica E-value=1e-63; GDP-mannose 3,5-epimerase 1 OS=Oryza sativa subsp. indica E-value=7e-63; GDP-mannose 3,5-epimerase 2 OS=Oryza sativa subsp. japonica E-value=3e-60; |
Length | 435 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_INSECT; |
Sequence | CTCATACCTCTTCTCTCCGTACATTATCGTCATATCAATCAATCAGAATGGGAAGCACTG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 833002 |
Trichome-related Gene from Literature | N/A |