| Detail of EST/Unigene BF639459 |
| Acc. | BF639459 |
| Internal Acc. | NF011A09IN1F1066 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Linoleate 9S-lipoxygenase OS=Lens culinaris E-value=5e-73; Linoleate 9S-lipoxygenase-4 OS=Glycine max E-value=4e-65; Linoleate 9S-lipoxygenase (Fragment) OS=Phaseolus vulgaris E-value=2e-64; Seed linoleate 9S-lipoxygenase-3 OS=Glycine max E-value=2e-62; Seed linoleate 9S-lipoxygenase-3 OS=Pisum sativum E-value=1e-61; |
| Length | 507 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_INSECT; |
| Sequence | ATTTTCTTAGCAACGTTAGCCCAATACCATTGTTCACGGAACTTTTTCGATCTGATGGTG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K00461 arachidonate 5-lipoxygenase; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K00461 arachidonate 5-lipoxygenase; Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K08021 arachidonate 12-lipoxygenase (R-type) |
| EC | 1.13.11.- 1.13.11.34 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 841944 |
| Trichome-related Gene from Literature | 841944 |