Detail of EST/Unigene BF639468 |
Acc. | BF639468 |
Internal Acc. | NF012E06IN1F1040 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 13, chloroplastic OS=Solanum lycopersicum E-value=7e-60; Chlorophyll a-b binding protein of LHCII type III, chloroplastic OS=Hordeum vulgare E-value=4e-54; Chlorophyll a-b binding protein 8, chloroplastic OS=Pisum sativum E-value=1e-37; Chlorophyll a-b binding protein AB80, chloroplastic OS=Pisum sativum E-value=2e-37; Chlorophyll a-b binding protein 4, chloroplastic OS=Solanum lycopersicum E-value=4e-37; |
Length | 388 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_INSECT; |
Sequence | GCCTCAGCAGCCTGTTGTTAAACAAACCTCCTTTCCTTGGTCAAAGGAAGGGTGCTGCCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 835515 |
Trichome-related Gene from Literature | N/A |