Detail of EST/Unigene BF639558 |
Acc. | BF639558 |
Internal Acc. | NF013F04IN1F1043 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 50S ribosomal protein L21, chloroplastic OS=Spinacia oleracea E-value=5e-20; 50S ribosomal protein L21, chloroplastic OS=Arabidopsis thaliana E-value=5e-20; 50S ribosomal protein L21, mitochondrial OS=Arabidopsis thaliana E-value=4e-08; 50S ribosomal protein L21 OS=Dictyoglomus turgidum (strain Z-1310 / DSM 6724) E-value=5e-07; Probable 39S ribosomal protein L21, mitochondrial OS=Dictyostelium discoideum E-value=1e-06; |
Length | 506 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_INSECT; |
Sequence | TTGAGAGAGAGAGAGAGGAAGTTCTCTCTTCTTCAAAATGGCTTCTGCAACTGCTTCTAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 840472 |
Trichome-related Gene from Literature | N/A |