| Detail of EST/Unigene BF639687 |
| Acc. | BF639687 |
| Internal Acc. | NF019E02IN1F1008 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | (3S,6E)-nerolidol synthase 1 OS=Fragaria ananassa E-value=3e-23; (3S,6E)-nerolidol synthase 1, chloroplastic OS=Fragaria vesca E-value=6e-22; (3S,6E)-nerolidol synthase 2, chloroplastic/mitochondrial OS=Fragaria ananassa E-value=4e-21; Tricyclene synthase TPS4, chloroplastic OS=Medicago truncatula E-value=1e-20; Viridiflorene synthase OS=Solanum lycopersicum E-value=9e-20; |
| Length | 661 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_INSECT; |
| Sequence | GACACGTTACTAACAATCTAAATCTATGGCTTTTTCTCTTTCTTTCGCTACTTCAACCAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 842465 |
| Trichome-related Gene from Literature | N/A |