Detail of EST/Unigene BF639687 |
Acc. | BF639687 |
Internal Acc. | NF019E02IN1F1008 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | (3S,6E)-nerolidol synthase 1 OS=Fragaria ananassa E-value=3e-23; (3S,6E)-nerolidol synthase 1, chloroplastic OS=Fragaria vesca E-value=6e-22; (3S,6E)-nerolidol synthase 2, chloroplastic/mitochondrial OS=Fragaria ananassa E-value=4e-21; Tricyclene synthase TPS4, chloroplastic OS=Medicago truncatula E-value=1e-20; Viridiflorene synthase OS=Solanum lycopersicum E-value=9e-20; |
Length | 661 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_INSECT; |
Sequence | GACACGTTACTAACAATCTAAATCTATGGCTTTTTCTCTTTCTTTCGCTACTTCAACCAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 842465 |
Trichome-related Gene from Literature | N/A |