| Detail of EST/Unigene BF639710 |
| Acc. | BF639710 |
| Internal Acc. | NF017D03IN1F1028 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Lipoxygenase 2.3, chloroplastic OS=Hordeum vulgare E-value=7e-18; Linoleate 13S-lipoxygenase 2-1, chloroplastic OS=Solanum tuberosum E-value=6e-16; Probable lipoxygenase 8, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-13; Lipoxygenase 7, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-12; Lipoxygenase 3, chloroplastic OS=Arabidopsis thaliana E-value=4e-09; |
| Length | 574 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_INSECT; |
| Sequence | CTCTCCCTCTTCTCATTCCTCAATTATTATTTATAGTATAAATCTTAGTGCATTATCTTA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 838314 |
| Trichome-related Gene from Literature | N/A |