Detail of EST/Unigene BF639835 |
Acc. | BF639835 |
Internal Acc. | NF026G07IN1F1055 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glutamine synthetase leaf isozyme, chloroplastic OS=Medicago sativa E-value=4e-59; Glutamine synthetase leaf isozyme, chloroplastic OS=Pisum sativum E-value=3e-54; Glutamine synthetase leaf isozyme, chloroplastic OS=Phaseolus vulgaris E-value=4e-47; Glutamine synthetase, chloroplastic OS=Daucus carota E-value=4e-44; Glutamine synthetase, chloroplastic OS=Brassica napus E-value=6e-38; |
Length | 406 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_INSECT; |
Sequence | ATTTCCTAAGTTTGCAGCTTTTTGCCATTTTTCAACTCTGTATTGAACATGGCACAGATT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Energy Metabolism > ko00910 Nitrogen metabolism > K01915 glutamine synthetase; Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K01915 glutamine synthetase; Metabolism > Glycan Biosynthesis and Metabolism > ko00550 Peptidoglycan biosynthesis > K01915 glutamine synthetase; Environmental Information Processing > Signal Transduction > ko02020 Two-component system > K01915 glutamine synthetase |
EC | 6.3.1.2 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 833535 |
Trichome-related Gene from Literature | N/A |